British Journal of Anaesthesia, 2002, Vol. 88, No. 4 508-515
© 2002 The Board of Management and Trustees of the British Journal of Anaesthesia
Clinical Investigations |
Malignant hyperthermia associated with exercise-induced rhabdomyolysis or congenital abnormalities and a novel RYR1 mutation in New Zealand and Australian pedigrees
Departments of 1Neuropathology and 2Anaesthesia, Royal Perth Hospital, Perth, Western Australia. 3Institute of Molecular BioSciences, Massey University, Palmerston North, New Zealand. 4Anaesthetic Department, Christchurch Hospital, Private Bag 4710, Christchurch, New Zealand. 5Centre for Neuromuscular and Neurological Disorders, University of Western Australia, Perth, Australia. 6Department of Anaesthesia and Intensive Care, Palmerston North Hospital, Palmerston North, New Zealand 7Present address: Department of Medical Genetics, Wellcome Trust/MRC Building, Addenbrookes Hospital, Cambridge CB2 2XY, UK 8Present address: Central Region Genetic Service, Wellington Hospital, Wellington South, New Zealand 9Present address: Department of Genetics, The University of Melbourne, Victoria, 3010, Australia*Corresponding author
Accepted for publication: November 16, 2001
| Abstract |
|---|
|
|
|---|
Malignant hyperthermia (MH) is rarely associated with specific myopathies or musculoskeletal abnormalities. Three clinical investigations of MH associated with either non-specific myopathies or congenital disorders in three separate families are presented. Two of these cases also show evidence of exercise-induced rhabdomyolysis. In each case MH susceptibility was confirmed by in vitro contracture testing of quadriceps muscle. DNA sequence analysis of each kindred revealed the presence of a common novel mutation that results in an arginine401cysteine substitution in the skeletal muscle ryanodine receptor gene (RYR1). Haplotype analysis using chromosome 19q markers indicated that the three families are likely to be unrelated, providing confirmation that the MH/central core disease region 1 of RYR1 is a mutation hot spot.
Br J Anaesth 2002; 88: 50815
Keywords: genetic factors, hyperthermia; complications, malignant hyperthermia; complications, myopathy; complications, exercise-induced rhabdomyolysis; receptors, ryanodine
| Introduction |
|---|
|
|
|---|
Malignant hyperthermia (MH) is a pharmacogenetic disorder that predisposes to a potentially fatal hypermetabolic reaction to inhalational anaesthetics and depolarizing neuromuscular blocking agents.1 An association with MH has been firmly established for three rare myopathies: central core disease (CCD), Evans myopathy and KingDenborough syndrome.2 3 These conditions predispose to a drug-induced increase in myoplasmic calcium, which leads to hyperthermia, hypoxia and acidosis.4 5 The association between MH and other myopathies is less clear,6 7 with inconsistencies between the results of in vitro contracture testing (IVCT) and reactions under anaesthesia. In addition, MH-like symptoms unrelated to anaesthesia have been associated with strenuous exercise, excitement or environmental heat.813 More recently, the connection between MH and exercise has been substantiated by the demonstration of both positive IVCT and the presence of ryanodine receptor (RYR) mutations in patients with a history of exercise-induced rhabdomyolysis (EIR).14 15 Molecular genetic studies have mapped the primary MH-susceptibility locus to the RYR1 gene on human chromosome 19q 13.1,16 17 where 28 missense mutations have been identified to date.1823 The majority of RYR1 mutations appear to be clustered between amino acid residues 35 and 614 (MH/CCD region 1) and amino acid residues 2163 and 2458 (MH/CCD region 2) and are predicted to reside in the myoplasmic foot region of the protein.24 25 A third region for mutations (MH/CCD region 3) has recently been identified and is predicted to be in the luminal/transmembrane domain of the protein.19 22 26 27 Here we report the clinical and molecular genetic analysis of three unrelated families with non-specific myopathies associated with EIR or congenital musculoskeletal abnormalites which indicate that the same single missense mutation in MH/CCD region 1 co-segregates with MH susceptibility (MHS) in each family.
| Methods |
|---|
|
|
|---|
Patients and samples
Blood and tissue samples were obtained following informed consent from members of three families participating in this study. Ethical approval was obtained from the Manawatu-Whanganui and Massey University Ethics Committees or from the Human Rights Committee, Research Administration Unit, The University of Western Australia.
In vitro contracture testing
IVCT of muscle biopsies was carried out according to the European MH group protocol.28 IVCT is based on contracture tensions induced in muscle in vitro by caffeine and halothane. A diagnosis of MHS is made when contractures of 0.2 g or greater are induced individually by a halothane concentration of 2% or less and a caffeine concentration of 2 mM or less. A diagnosis of MH equivocal (MHE) is made when contractures of 0.2 g or greater are induced with either halothane or caffeine, but not both, at the above concentrations.
Muscle histology
Histological examination using both light microscopy and electron microscopy was performed in the Western Australian laboratory on samples from all patients tested for susceptibility to MH. Light microscopy only was carried out in the New Zealand laboratory. Ten-micron sections from frozen muscle specimens were stained or reacted for hematoxylin and eosin, modified Gomori trichrome, NADH-tetrazolium reductase, ATPase, acid phosphatase, periodic acidSchiff, and oil red O.29
Mutation screening by RT-PCR and DNA sequencing
Total RNA was extracted from 30100 mg frozen skeletal muscle tissue using TrizolTM RNA extraction reagent (Invitrogen, Groningen, The Netherlands). First strand synthesis was carried out using the Superscript reverse transcriptase (RT) pre-amplification system (Invitrogen) with 4 µg total RNA and either 50 ng random hexamers or 500 ng oligo(dT) in a 20 µl volume. Hot-start polymerase chain reaction (PCR) was performed using 1 µl of a 20-fold dilution of the first strand cDNA reaction in 50 µl reactions with 0.32 µM of each primer, 0.3 mM dNTPs, 1.5 mM MgCl2 and 1.5 U Taq polymerase (Invitrogen). MH/CCD region 1 was amplified in three overlapping 816 bp, 824 bp, and 578 bp fragments using the following primer pairs: CAGGAGGACGCAACAGGAGAG/GTTGTATAGGCC ATTGGTGCT; TCCAAGGAGAAGCTGGATGTGG/TG CTTGTCCAGGAGGGAGATG and CTCTCCATGGTC CTGAATTGCATAGAC/AGTCACCTCGTCCACCATC AC, respectively. MH/CCD region 2 was amplified in one 1101 bp fragment using the CAGTACGACGGGCTGGGTGAG/GGATGCTGACATCTTTGGCT primer pair. MH/CCD region 3 was amplified in one 630 bp region using the GAACCCGCCCTGCGCTGTCTG/GTAGACGACCACCGCCAGAAG primer pair. PCR products were purified using the ConcertTM rapid PCR product purification kit (Invitrogen) and then screened for the presence of mutations by automated DNA sequencing using an ABI 377-36 or 373 with Big-Dye terminator chemistry (Applied Biosystems, New Zealand). Exon 12 of RYR1 was amplified from genomic DNA using primers 1143F and 1213R,5 purified using the ConcertTM rapid PCR product purification kit (Invitrogen) and sequenced from the forward primer using an ABI 377-36 or 373 with Big-Dye terminator chemistry (Applied Biosystems).
SSCP analysis and allele-specific PCR
Genomic DNA was isolated using the Wizard DNA extraction kit (Promega Corporation, Madison, USA) according to the manufacturers instructions. Exon 12 of RYR1 was amplified as above and screened for the presence of the C1201T mutation by single-stranded conformation polymorphism (SSCP) analysis using 12% 29:1 polyacrylamide gel electrophoresis. Alternatively, an allele-specific probe (CAGGCCGCCCGCATGAT) labelled with fluorescein together with an anchor probe (CAGCACCAATGGCCTATACAACCAGTTCATCAAGTGA) labelled with LC-red 640 was used to detect the presence of the C1201T mutation by real-time amplification of genomic DNA using a Light Cycler (Roche Diagnostics, NZ Ltd, Auckland, New Zealand).30 31 The sequences of the flanking primers were as follows: CTCTGTCTCCCCACTCCTA (forward) and GGCAACAGAGGTAGAGATGAA (reverse). The oligonucleotide primers and probes were designed using the software MeltCalc (http://www. meltcalc.de). The following thermocycling protocol was used for amplification: denaturation at 95°C for 120 s, followed by 45 cycles of: 95°C for 0 s, 55°C for 10 s, 72°C for 11 s, with a temperature transition rate of 20°C s1 and data acquisition at the annealing step. The melting curve analysis was as follows: 95°C for 0 s, 45°C for 30 s, with a temperature transition rate of 20°C s1, followed by 75°C for 0 s at a temperature transition rate of 0.1°C s1 with continuous data acquisition. For each step in the protocol the fluorescence display was F2/1. The melting temperatures of the wild-type and mutant alleles were 64.5°C and 57.5°C, respectively.
Haplotype analysis
Haplotype analysis was carried out using the D19S22032 33 and D19S4734 chromosome 19q microsatellite repeat markers that flank the RYR1 locus. The forward primer of each pair was labelled with 6-FAM and the microsatellite regions were amplified independently using standard PCR reactions. The reactions were diluted 1:5 in distilled water, pooled, and analysed on an ABI 37736 using Genescan software (Applied Biosystems). Allele identities and frequencies were as published. Three intragenic restriction fragment length polymorphism (RFLP) markers,35 Ile1151 (Taq I), Asp2729 (Fok I) and Ser 2862 (Cfo I), were typed by restriction endonuclease digestion of the amplified polymorphic regions. By convention, alleles that lack the polymorphic restriction sites were denoted 1 and those with the polymorphic restriction endonuclease sites were denoted 2.
SNAPshotTM mutation detection
A SNAPshotTM (Applied Biosystems) dideoxy primer extension method was used as a diagnostic test for the presence of the C1201T mutation according to the manufacturers instructions. PCR products were amplified from genomic DNA using the exon 12 primers described above and purified using the ConcertTM rapid PCR product purification kit (Life Technologies, Auckland, New Zealand). Five nanograms of PCR product were used in the primer extension reaction with the primer TGGTGCTGTGGATCATGC and the reactions were analysed on an ABI 37764 using Genescan software (Applied Biosystems).
| Results |
|---|
|
|
|---|
Clinical investigation
Family 1
The proband (III-1, Fig. 1A) was a 45 kg, 11-year-old male of Maori descent undergoing dental treatment under general anaesthesia. He had previously had uneventful anaesthesia at 9 years of age for a similar procedure. There was no known personal or family history of anaesthetic problems or any adverse reactions during or after exercise.
|
The patient was premedicated with oral midazolam 7.5 mg. Propofol 100 mg i.v. and suxamethonium 50 mg i.v. were used for induction and intubation. There was no masseter spasm at induction. Anaesthesia was maintained with halothane and spontaneous breathing. During the first 20 min the heart rate increased from 100 to 120 beats min1 but this settled partially with fentanyl 40 µg. However, over the next 30 min the heart rate increased to 140 beats min1 and the end tidal CO2 (E'CO2) increased from 50 to 65 mm Hg towards the end of the procedure, about 55 min after induction. At insertion of a paracetamol suppository, it was noticed that the legs were stiff. An MH reaction, which had been considered earlier, was strongly suspected because of the muscle rigidity. Halothane was discontinued and 100% oxygen given from a cylinder by Laerdal bag. Axillary temperature was 37.5°C. Clothing was removed and the air conditioning was switched on, but no active cooling was undertaken. The temperature reached a maximum of 38.2°C and the E'CO2 70 mm Hg over the next 8 min, but the temperature had settled to 37.3°C 20 min later. Arterial blood gases showed pH 7.28, PaCO2 50 mm Hg and base excess 2.0 mmol litre1. Serum potassium measured 4.0 mmol litre1. Initial creatine kinase (CK) was measured at 53 200 i.u. (normal range: 20215 i.u.) 2 h after the reaction, and the urine was strongly positive for myoglobin 6 h after the reaction. CK peaked at 165 000 i.u. 1 day after the reaction. There were no further problems, although the patient complained of aching arms and legs for 24 h.
IVCT conducted 2 yr later recorded a contracture of 5.5 g with 2% halothane (normal value <0.2 g) and 2.7 g with 2 mM caffeine (normal value <0.2 g), indicative of a strong MHS response. Histology and histochemistry were reported as normal. IVCT carried out at a later date in both mother (II-1, Fig. 1A; 2% halothane 1.7 g, 2 mM caffeine 0.35 g) and one sibling (III-2, Fig. 1A; 2% halothane 2.8 g, 2 mM caffeine 1.9 g) were also indicative of MHS status.
The medical and anaesthetic histories of three siblings were also of interest. The older sibling (III-2, Fig. 1A) had undergone repair of harelip and cleft palate in infancy. However, anaesthetic records were unavailable. Two younger siblings (III-4 and III-5, Fig. 1A) had received multiple anaesthetics for clubfoot surgery. The history of MH was unknown for these anaesthetic procedures and both children had received trigger agents. Neither child has been biopsied because of age, but in one procedure the younger of the two (III-5, Fig. 1A) developed tachycardia, pyrexia towards the end of the operation and tachypnoea in recovery. The older of the two (III-4, Fig.1A) had similar findings, with increased E'CO2. In retrospect these may have been developing MH reactions.
Family 2
The proband (I-2, Fig. 1B) was referred for muscle biopsy because of a history of sporadically elevated CK levels (5212 and 203 i.u.) and intermittent muscle pain and muscle cramps, often precipitated by exercise. These episodes occurred several years apart but lasted for 2 weeks, with difficulty in walking because of muscle pain rather than weakness. She had no previous general anaesthetics and there were no anaesthetic records for other family members. IVCT was indicative of MHS status and demonstrated a static halothane threshold of 1% (maximum contraction of 1.8 g), a dynamic halothane threshold of 1% (maximum contraction of 1.3 g) and a caffeine threshold of 1.0 mM. Histology showed numerous basophilic fibres with prominent nuclei and non-specific necrosis, type 2 fibre predominance with type 1 grouping. Regeneration was in phase, suggesting recent specific muscle injury coinciding with the high CK (5212 i.u.) and her symptoms at referral. Electron microscopy showed a few atrophic fibres with a few areas of Z-band streaming. A neurological examination was normal. Her son (II-1, Fig. 1B), who routinely suffers from muscle cramps after playing sport, also tested MHS by IVCT, with a static halothane threshold of 1% (maximum contraction of 0.8 g), a dynamic halothane threshold of 0.5% (maximum contraction of 1.2 g) and a caffeine threshold of 1.5 mM. Histology and histochemistry were normal.
Family 3
The proband (II-1, Fig. 1C) was referred for muscle biopsy because of elevated serum enzymes after exercise in hot weather, and a history of muscle cramps. CK was recorded at 899 i.u.. He had previously undergone two general anaesthetics with no apparent problems. IVCT results were indicative of MHS status: static halothane threshold of 0.5% (maximum contraction of 1.4 g), a dynamic halothane threshold of 0.5% (maximum contraction of 2 g) and a caffeine threshold of 1.5 mM. Histology and histochemistry showed an increased variability in fibre size and an increased number of internal nuclei in 30% of 140 fibres. Two of his daughters (III-1 and III-2, Fig. 1C) tested MHE by IVCT with the following results. III-1: static halothane normal, dynamic halothane threshold at 0.5% (maximum contraction of 0.5 g) and caffeine normal; III-2: static halothane threshold of 2% (maximum contraction of 0.4 g), dynamic halothane threshold of 0.5% (maximum contraction of 0.5 g) and caffeine normal. A neurological examination showed no evidence of clinical signs that might indicate MH. One of the probands daughters (III-1, Fig. 1C) had had four uneventful general anaesthetics and the muscle was morphologically unremarkable, with no evidence of myositis or other recognizable pathology. The other daughter (III-2, Fig. 1C) had no anaesthetic history, and normal skeletal muscle by histology. Electron microscopy showed some atrophic fibres indicative of non-specific atrophy.
RYR1 mutation screening
The RYR1 gene contains 106 exons spanning 160 kb of DNA36 but most MH-associated mutations are located within three hot-spot regions, designated MH/CCD regions 1, 2 and 3.19 Each of these regions was amplified using RT-PCR from RNA prepared from muscle biopsy tissue from individual III-1 in family 1 (Fig. 1A) and sequenced in both directions. Two novel silent polymorphisms (cgc/t-R2403 and gcc/t-A2427) were detected and one missense C1201T mutation (in exon 12 of RYR1) that substitutes Arg401 for Cys. Exon 12 was amplified from genomic DNA from the probands mother (II-1, family 1) and each of her offspring (III-2, III-4 and III-5), and sequenced. The C1201T mutation was identified in each of these individuals.
The C1201T mutation was also identified in individuals I-2 (Fig. 1B) and II-1 (Fig. 1C) after sequencing the majority of the RYR1 cDNA as described previously.19 The mutation was also identified in individual II-1 (Fig. 1B) by sequencing exon 12 amplified by PCR using primers 1143F and 1213R.5 The C1201T mutation was not identified in the two MHE individuals (III-1 and III-2 from family 3; Fig. 1C).
As the C1201T transition does not alter any informative restriction sites, alternative methods were used to screen for the mutation in the normal population. A total of 200 unrelated DNA samples (400 chromosomes) were screened by SSCP analysis or allele-specific PCR using the Light Cycler by amplifying genomic DNA. The mutation was not detected in any normal chromosomes from unrelated control subjects of either Maori or Caucasian descent. The mutation was also absent from MHS individuals in 32 unrelated New Zealand MH pedigrees, including three of Maori origin, as well as 21 unrelated Western Australian pedigrees.
Haplotype analysis
Microsatellite markers flanking the RYR1 locus and three intragenic RFLP markers were used to analyse the chromosome 19q13.1 genotype in each of the three families.3234 This analysis revealed a common haplotype that segregated with MHS in family 1 (Fig. 1A) although the small size of the pedigree prohibited a statistical evaluation. The markers were less informative for the Australian families. However, the 7 allele of the D19S220 marker32 33 clearly segregated with MHS in the New Zealand kindred (Fig. 1A) but was not present in either of the Australian families (Fig. 1B and 1C). The D19S47 genotypes were identical (4,8) for the two Australian families and a common allele is shared at the D19S220 locus (6,6 and 3,6) for families 2 and 3, respectively. The RFLP markers were all homozygous for family 2 and all heterozygous for family 3. However, insufficient samples were available for families 2 and 3 to allow phasing of the alleles to be determined, so the genotyping was of limited value.
Diagnostic testing for the C1201T mutation
Dideoxy primer extension (SNAPshotTM) was used to distinguish between the normal and mutant allele for family 1. DNA from all individuals known to have the C1201T mutation, as well as from 20 normal samples, was analysed by this method. The heterozygote can be clearly distinguished from the normal homozygote (Fig. 2).
|
| Discussion |
|---|
|
|
|---|
Increased E'CO2, inappropriate sinus tachycardia, muscular rigidity and evidence of muscle breakdown in addition to a rapid increase in temperature are all convincing evidence of a MH reaction in the proband of family 1 (III-1, Fig. 1A). This would achieve a rank of 6 on the MH clinical grading scale,37 a description of the likelihood that a MH event was almost certain. A strong positive IVCT in the proband and in other family members confirms an MH reaction.
Sequencing of either the entire RYR1 cDNA or mutation hot-spot regions of the RYR1 cDNA in three individuals suspected of being MHS has identified a novel C1201T transition that results in an Arg401Cys substitution in the N-terminal region of the RYR. All individuals from the three families investigated who were classified as MHS by IVCT also had the C1201T mutation. This mutation was not found in any of 200 normal individuals or in 32 New Zealand or 21 Australian MH families. These observations strongly suggest that the C1201T mutation is causative of MH in these three families. The mutation is situated two residues upstream of an Ile403Met mutation that has been shown previously to be associated with both MH and CCD in an Italian family.5 There was no evidence of CCD in any of the pedigrees with the C1201T mutation. Residue Arg401 is strictly conserved across all known sequences from the RYR family (Fig. 3). This, together with the proximity of the mutation to the previously reported Ile403Met mutation5 implies that this residue is functionally significant and is an important region in the MH disorder. Indeed, studies of calcium release using normal and mutant RYR-transfected HEK-293 cells have shown that the Ile403Met mutation is significantly more sensitive to both caffeine and halothane38 and is associated with higher resting cytoplasmic calcium levels, implying that the mutant channel may be leaky.39
|
The novel RYR1 mutation discovered in one New Zealand and two Australian MH families could have arisen independently or as a result of a founder effect. To distinguish between these two possibilities, the haplotype at the RYR1 locus was determined using two highly polymorphic chromosome 19 microsatellite markers (D19S4734 and D19S22032 33) as well as three intragenic RFLP markers.35 The inheritance of the allele haplotype 72218 for the markers D19S220, Ile1151, Asp2729, Ser 2862 and D19S47, respectively, coincides with the inheritance of the MHS phenotype in family 1 (Fig. 1A). It is worth noting that the D19S220 allele 7 does not appear in families 2 and 3 (Fig. 1B and C). Without being able to determine chromosome phasing, no definite conclusion can be made concerning relatedness of these two families, but it is possible that the two Australian families share a common haplotype 62218. If this is the case, a single recombination event could produce the 72218 haplotype associated with MH in the New Zealand family. However, the probability that two patients with the same haplotype have a common ancestor is inversely related to the frequency of the haplotype in the appropriate general population. The 3 allele has the lowest occurrence of the 10 alleles identified at the D19S220 locus, and the 6 allele is intermediate; the 4 and 8 alleles have the two highest frequencies of the nine alleles reported at the D19S47 locus. In addition, the frequency of recombination is related to the distance between two markers. Since the distance between D19S220 and RYR1 is
0.8 centimorgan, recombination can be considered as minimal but cannot be completely ruled out. These observations, together with knowledge of the individual family histories, suggest that the Australian families are unlikely to be related to the New Zealand family and that the mutations have probably occurred independently. More importantly, the discovery of the C1201T mutation in three MH families supports the designation of the MH/CCD region 1 as a mutation hot spot. The C-to-T transition occurs at a CpG dinucleotide, which is a well-known mutation hot spot. In two recent reports EIR has been correlated with mutations in RYR1 that are also causative of MH.14 15 These are the first reports providing clear evidence of mutations that cause MH also being associated with EIR. Numerous earlier reports have linked EIR with MH susceptibility by demonstrating a positive IVCT.9 10 40 41 Here we report a novel RYR1 mutation that has been identified in three separate MHS families, including two where the mutation is associated with EIR. Three siblings of family 1 (Fig. 1A) also had congenital musculoskeletal or connective tissue abnormalities. It is interesting to ask why the C1201T RYR1 mutation appears to provide different phenotypes, that is MH alone, MH plus congenital abnormalities, or MH with EIR. It is possible that other genetic factors contribute to different MH phenotypes, as proposed by Robinson and colleagues.42 The RYR1 defect could account for the MHS phenotype, while a mutation within another gene could modify this phenotype to produce either EIR or other musculoskeletal abnormalities. Clear evidence of the same RYR1 defect producing different phenotypes has been provided in the case of CCD and MH.21 Considering the variable penetrance of clinical MH, it is highly likely that modifier genes have an important role to play in this complex genetic disorder.
Congenital musculoskeletal and connective tissue abnormalities have been linked previously to MH susceptibility.43 Britt and Kalow43 noted a high incidence of abnormalities, including cramps, strabismus, hernia, hare lip and cleft palate, clubfoot, kyphoscoliosis, recurrent dislocating patella and other orthopaedic abnormalities. More recently, however, a prospective Scandinavian study of 210 patients investigated for MH found no significant increase in the incidence of congenital musculoskeletal or connective tissue abnormalities.44 In addition, Larach compared 198 patients with positive MH biopsies with 849 normal individuals with no personal or family history of MH, and found a similar incidence of muscle cramps in the two groups.45 Larach and colleagues also analysed 178 patients experiencing very likely or almost certain MH events and found a 22% incidence of musculoskeletal abnormalities, which included problems with muscle tone.46 The findings from a study of 400 patients undergoing IVCT in New Zealand indicate a low incidence of abnormalities (Pollock N; unpublished data).
Many of the abnormalities reported by Britt and Kalow43 occur with some frequency in the general population, and results of the later studies question whether an increased incidence of abnormalities exists in MHS individuals. However, these were largely retrospective studies and a large prospective study comparing MHS and MH normal individuals is required. MH-type reactions have, however, been reported in rare skeletal and connective tissue syndromes with genetic abnormalities.4750 Reactions have also been reported in families with musculoskeletal and connective tissue problems that affect multiple individuals,5154 with possible associated genetic abnormalities, as in family 1. In addition, the non-specific myopathic changes observed in families 2 and 3, as well as the incidence of EIR where there was also no known family history of MH suggest that an awareness of the possibility of an MH reaction in each of these groups may need to be exercised.
| Acknowledgements |
|---|
We would like to thank John MacKay of Roche Molecular Biochemicals for assistance with optimising the Light-Cycler protocol for allele-specific detection. R. Brown was supported by a Massey University Doctoral Scholarship. This work was supported by grants from the Australian and New Zealand College of Anaesthetists, The New Zealand Lotteries Grants Board and the Palmerston North Medical Research Foundation. N. Laing was supported by National Health and Medical Research Council Project grant 970104.
| References |
|---|
|
|
|---|
1 Denborough M, Lovell R. Anaesthetic deaths in a family. Lancet 1960; 2: 45
2 King JO, Denborough MA. Anesthetic-induced malignant hyperpyrexia in children. J Pediatr 1973; 83: 3740[ISI][Medline]
3 Jurkat-Rott K, McCarthy T, Lehmann-Horn F. Genetics and pathogenesis of malignant hyperthermia. Muscle Nerve 2000; 23: 417[ISI][Medline]
4 Isaacs H, Badenhorst ME. Dominantly inherited malignant hyperthermia (MH) in the King-Denborough syndrome. Muscle Nerve 1992; 15: 7402[ISI][Medline]
5 Quane KA, Healy JM, Keating KE, et al. Mutations in the ryanodine receptor gene in central core disease and malignant hyperthermia. Nature Genet 1993; 5: 515[ISI][Medline]
6 Wedel DJ. Malignant hyperthermia and neuromuscular disease. Neuromuscul Disord 1992; 2: 15762[Medline]
7
Vita GM, Olckers A, Jedmicka AE, et al. Masseter muscle rigidity associated with glycine1306-to-alanine mutation in the adult muscle sodium channel
-subunit gene. Anesthesiology 1995; 82: 1097103[ISI][Medline]
8
Gronert GA, Thompson RL, Onofrio BM. Human malignant hyperthermia: awake episodes and correction by dantrolene. Anesth Analg 1980; 59: 3778
9
Hackl W, Winkler M, Mauritz W, Sporn P, Steinbereithner K. Muscle biopsy for diagnosis of malignant hyperthermia susceptibility in two patients with severe exercise-induced myolysis. Br J Anaesth 1991; 66: 13840
10 Hopkins PM, Ellis FR, Halsall PJ. Evidence for related myopathies in exertional heat stroke and malignant hyperthermia. Lancet 1991; 338: 14912[ISI][Medline]
11 Hopkins PM, Ellis FR, Halsall PJ. Hypermetabolism in arthrogryposis multiplex congenita. Anaesthesia 1991; 46: 3745[ISI][Medline]
12 Jardon OM. Physiologic stress heat stroke malignant hyperthermia a perspective. Mil Med 1982; 147: 814[ISI][Medline]
13 Köchling A, Wappler F, Winkler G, Schulte am Esch J. Rhabdomyolysis following severe physical exercise in a patient with predisposition to malignant hyperthermia. Anaesth Intens Care 1998; 26: 3158[ISI][Medline]
14 Wappler F, Fiege M, Antz M, Schulte am Esch J. Hemodynamic and metabolic alterations in response to graded exercise in a patient susceptible to malignant hyperthermia. Anesthesiology 2000; 92: 26872[ISI][Medline]
15 Wappler F, Fiege M, Steinfath M, et al. Evidence for susceptibility to malignant hyperthermia in patients with exercise-induced rhabdomyolysis. Anesthesiology 2001; 94: 95100[ISI][Medline]
16 MacLennan DH, Duff C, Zorzato F, et al. Ryanodine receptor gene is a candidate for predisposition to malignant hyperthermia. Nature 1990; 343: 55961[Medline]
17 McCarthy TV, Healy JM, Heffron JJ, et al. Localization of the malignant hyperthermia susceptibility locus to human chromosome 19q1213.2. Nature 1990; 343: 5624[Medline]
18 Fortunato G, Berruti R, Brancadoro V, Fattore M, Salvatore FA, Carsana A. Identification of a novel mutation in the ryanodine receptor gene (RYR1) in a malignant hyperthermia Italian family. Eur J Hum Genet 2000; 8: 14952[ISI][Medline]
19
Brown RL, Pollock AN, Couchman KG, et al. A novel ryanodine receptor mutation and genotype-phenotype correlation in a large malignant hyperthermia New Zealand Maori pedigree. Hum Mol Genet 2000; 9: 151524
20
Chamley DAN, Pollock AN, Stowell KM, Brown RL. Malignant hyperthermia in infancy and identification of a novel RYR1 mutation. Br J Anaesth 2000; 84: 5004
21 McCarthy TV, Quane KA, Lynch PJ. Ryanodine receptor mutations in malignant hyperthermia and central core disease. Hum Mutat 2000; 15: 4107[ISI][Medline]
22
Monnier N, Romero NB, Lerale J, et al. An autosomal dominant congenital myopathy with cores and rods is associated with a neomutation in the RYR1 gene encoding the skeletal muscle ryanodine receptor. Hum Mol Genet 2000; 9: 2599608
23 Rueffert H, Kraus H, Olthoff D, Deutrich C, Froster UG. Identification of a novel mutation in the ryanodine receptor gene (RYR1) in patients with malignant hyperthermia. Hum Mutat 2001; 17: 238
24 Takeshima H, Nishimura S, Matsumoto T, et al. Primary structure and expression from complementary DNA of skeletal muscle ryanodine receptor. Nature 1989; 339: 43945[Medline]
25
Zorzato F, Fujii J, Otsu K, et al. Molecular cloning of cDNA encoding human and rabbit forms of the Ca2+ release channel (ryanodine receptor) of skeletal muscle sarcoplasmic reticulum. J Biol Chem 1990; 265: 224456
26
Lynch PL, Tong J, Lehane M, et al. A mutation in the transmembrane/luminal domain of the ryanodine receptor is associated with abnormal Ca2+ release channel function and severe central core disease. Proc Natl Acad Sci USA 1999; 96: 41649
27
Scacheri PC, Hoffman EP, Fratkin JD, et al. A novel ryanodine receptor gene mutation causing both cores and rods in congenital myopathy. Neurology 2000; 55: 168996
28
European Malignant Hyperpyrexia Group. A protocol for the investigation of malignant hyperpyrexia (MH) susceptibility. Br J Anaesth 1984; 56: 12679
29 Engel A. The Muscle Biopsy, 2nd Edn. Engel AG and Franzini-Armstrong C. New York: McGraw-Hill, 1994
30 Schutz E, von Ahsen N. Spreadsheet software for thermodynamic melting point prediction of oligonucleotide hybridization with and without mismatches. Biotechniques 1999; 27: 121822; 1224[ISI][Medline]
31
vonAhsen N, Oellerich M, Armstrong VW, Schutz E. Application of a thermodynamic nearest-neighbor model to estimate nucleic acid stability and optimize probe design: prediction of melting points of multiple mutations of apolipoprotein B-3500 and factor V with a hybridization probe genotyping assay on the LightCycler. Clin Chem 1999; 45: 2094101
32 Gyapay G, Morisette JM, Vignal A, et al. The 199394 Genethon human genetic linkage map. Nature Genet 1994; 7: 246339[ISI][Medline]
33 Weissenbach J, Gyapay G, Dib C, et al. A second-generation linkage map of the human genome. Nature 1992; 359: 794801[Medline]
34 Weber JL, May PE. Abundant class of human polymorphisms which can be typed using the polymerase chain reaction. Am J Hum Genet 1989; 44: 388396[ISI][Medline]
35 Gillard EF, Otsu K, Fujii J, et al. Polymorphisms and deduced amino acid substitutions in the coding sequence of the ryanodine receptor (RYR1) gene in individuals with malignant hyperthermia. Genomics 1992; 13: 124754[ISI][Medline]
36 Phillips MS, Fujii J, Khanna VK, et al. The structural organization of the human skeletal muscle ryanodine receptor (RYR1) gene. Genomics 1996; 34: 2441[ISI][Medline]
37 Larach MG, Localio AR, Allen GC, et al. A clinical grading scale to predict malignant hyperthermia susceptibility. Anesthesiology 1994; 80: 7719[ISI][Medline]
38
Tong J, Oyamada H, Demaurex N, Grinstein S, McCarthy TV, MacLennan DH. Caffeine and halothane sensitivity of intracellular Ca2+ release is altered by 15 calcium release channel (ryanodine receptor) mutations associated with malignant hyperthermia and/or central core disease. J Biol Chem 1997; 272: 263329
39
Tong J, McCarthy TV, MacLennan DH. Measurement of resting cytosolic Ca2+ concentrations and Ca2+ store size in HEK-293 cells transfected with malignant hyperthermia or central core disease mutant Ca2+ release channels. J Biol Chem 1999; 274: 693702
40 Denborough MA. Maligant hyperexia heat-stroke and sudden infant death. Fellowship Affairs 1990: 1314
41 Hunter SL, Rosenberg H, Tuttle GH, DeWalt JL, Smodic R, Martin J. Malignant hyperthermia in a college football player. Physician Sports Med 1987; 15: 7784
42 Robinson RL, Curran JL, Ellis FR, et al. Multiple interacting gene products may influence susceptibility to malignant hyperthermia. Ann Hum Genet 2000; 64: 30720[ISI][Medline]
43 Britt BA, Kalow W. Malignant hyperthermia: A statistical review. Can Anaesth Soc J 1970; 17: 293315[ISI][Medline]
44
Ørding H, Ranklev E, Fletcher R. Investigation of malignant hyperthermia in Denmark and Sweden. Br J Anaesth 1984; 56: 118390
45 Larach MG. MHAUS Malignant Hyperthermia Survey. Communicator 1988; 14
46 Larach MG, Furhmann LJ, Allen GC. The North American Hyperthermia Registry: Epidemiology of malignant hyperthermia events in North America. Third International Symposium on Malignant Hyperthermia. Tokyo: Springer-Verlag, 1996; 3941
47 Froster-Iskenius UG, Waterson JR, Hall JG. A recessive form of congenital contractures and torticollis associated with malignant hyperthermia. J Med Genet 1988; 25: 10412[Abstract]
48 Ginsburg R, Purcell-Jones G. Malignant hyperthermia in the WolfHirschhorn syndrome. Anaesthesia 1988; 43: 3868[ISI][Medline]
49 Robinson LK, OBrien NC, Puckett MC, Cox MA. Multiple pterygium syndrome: a case complicated by malignant hyperthermia. Clin Genet 1987; 32: 59[ISI][Medline]
50 Heiman-Patterson TD, Rosenberg HR, Binning CP, Tahmoush AJ. King-Denborough syndrome: contracture testing and literature review. Pediatr Neurol 1986; 2: 1757[Medline]
51
Jardon OM, Wingard DW, Barak AJ, Connolly JF. Malignant hyperthermia. A potentially fatal syndrome in orthopaedic patients. J Bone Joint Surg Am 1979; 61: 106470
52 Isaacs H, Gericke G. Concurrence of malignant hyperthermia and congenital abnormalities. Muscle Nerve 1990; 13: 9157[ISI][Medline]
53
Isaacs H, Barlow MB. Malignant hyperpyrexia occurring in a second Johannesburg family. Br J Anaesth 1973; 45: 9016
54 Gericke GS, Isaacs H. An association between certain congenital abnormalities and the malignant hyperthermia trait. S Afr Med J 1990; 77: 5704[ISI][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
R. R. Johi, R. Mills, P. J. Halsall, and P. M. Hopkins Anaesthetic management of coronary artery bypass grafting in a patient with central core disease and susceptibility to malignant hyperthermia on statin therapy Br. J. Anaesth., November 1, 2003; 91(5): 744 - 747. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Tammaro, A. Bracco, S. Cozzolino, M. Esposito, A. Di Martino, G. Savoia, L. Zeuli, G. Piluso, S. Aurino, and V. Nigro Scanning for Mutations of the Ryanodine Receptor (RYR1) Gene by Denaturing HPLC: Detection of Three Novel Malignant Hyperthermia Alleles Clin. Chem., May 1, 2003; 49(5): 761 - 768. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




